dCAS9-VP64_GFP (Plasmid #61422)

Print

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 61422

Standard format: Plasmid sent in bacteria as agar stab

1 $75

Concentrated Lentiviral Prep 61422-LVC

Virus (50µL at titer ≥ 2.5×10⁶ TU/mL)

and Plasmid.

More Information

$180

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Ampicillin

  • 37°C

  • Stbl3

  • none

  • High Copy

Gene/Insert

  • dCAS9(D10A,H840A)-VP64_2A_GFP

  • Synthetic; S. pyogenes

  • D10A and H840A in Cas9

  • Promoter
    EF1A

Cloning Information

  • Cloning method
    Restriction Enzyme
  • 5′ cloning site
    BsiWI
    (not destroyed)
  • 3′ cloning site
    EcoRI
    (not destroyed)
  • 5′ sequencing primer
    GTT TGG ATC TTG GTT CAT TCT CAA GCC TCA G
  • 3′ sequencing primer
    cacatagcgtaaaaggagcaacatag
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

For additional information, protocols and an activator sgRNA design tool, visit our website: http://sam.genome-engineering.org/

Information for Concentrated Lentiviral Prep (Catalog # 61422-LVC)

(
Back to top
)

Purpose

Ready-to-use Concentrated Lentiviral Prep particles produced from dCAS9-VP64_GFP (#61422). In addition to the viral particles, you will also receive purified dCAS9-VP64_GFP plasmid DNA.

Delivery

  • Volume
    50 µL
  • Titer
    ≥2.5×10⁶ TU/mL
  • Pricing
    $150 USD for preparation of 50 µL virus + $30 USD for plasmid.
  • Storage
    Store at -80℃. Thaw just before use and keep on ice.
  • Shipment
    Viral particles are shipped frozen on dry ice.
    Plasmid DNA (≥ 200ng) will also be included
    in the shipment.

Viral Production & Use

  • Packaging Plasmids
    psPAX2 (plasmid #12260)
  • Envelope
    pMD2.G (plasmid #12259)
  • Buffer
    PBS
  • Selectable Marker
    GFP
  • Purification
    Lentivirus was harvested from cell culture medium (DMEM + 10% FBS). Lentiviral particles were then collected by precipitation in polyethylene glycol (PEG) followed by centrifugation. Precipitated pellets containing viral particles were resuspended in PBS.

Biosafety

Requestor is responsible for compliance with
their institution’s biosafety regulations.
Lentivirus is generally considered BSL-2. AAV is
generally considered BSL-1, but may require
BSL-2 handling depending on the insert.
Biosafety Guide

Resource Information

Viral Quality Control

Titering Method:

Notes:

  • Quality control was performed on this lentiviral preparation prior to concentration. Results and explanations of quality control methods can be seen in the Information for Lentiviral Prep section on this page.

Visit our viral production page for more information.

How to cite this plasmid

( Back to top)

These plasmids were created by your colleagues. Please acknowledge the
Principal Investigator, cite the article in which the plasmids were described,
and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    dCAS9-VP64_GFP
    was a gift from

    Feng Zhang

    (Addgene plasmid # 61422 ; http://n2t.net/addgene:61422 ; RRID:Addgene_61422)

    For viral preps, please replace (Addgene plasmid # 61422)
    in the above sentence with:

    (Addgene viral prep # 61422-LVC)

  • For your References section:

    Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex.
    Konermann S, Brigham MD, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H, Nureki O, Zhang F.
    Nature. 2014 Dec 10. doi: 10.1038/nature14136.
    10.1038/nature14136


    PubMed 25494202

Measure

Measure

点击数:0